The beads were washed four times in ice cold lysis buffer, treated with SDS sample buffer before being subjected to SDS-PAGE electrophoresis to detect proteins.For immunostaining, NTCP-HepG2 or T23 cultured cells grown on glass slides were fixed with formalin for 10 minutes and permeabilized with 0.25% Triton X-100 (Merck, Darmstadt, Germany) in 10 mM PBS (pH 7.5) for 10 minutes at room temperature. The reaction was stopped by glycine followed by cell lysis with the cold lysis buffer provided in the kit. The TARDBP target sequences of the 4 siRNAs contained in the pool are: GGCCUUCGGUUCUGGAAAU, GCAAACUUCCUAAUUCUAA, CAAUAGCAAUAGACAGUUA and GCUCAAGCAUGGAUUCUAA).Control shRNA and shRNA TARDBP (TARDBP MISSION shRNA TRCN0000016040: CCGGGCTTTGGCTCAAGCATGGATTCTCGAGAATCCATGCTTGAGCCAAAGCTTTTT) in the form of Lentiviral Transduction Particles were purchased from Sigma Aldrich, Japan.Plasmids used in establishment of NTCP-HepG2 knock out (KO) cells were constructed as follows: for the knock-in donor plasmids, the left and right homology arms of the TARDBP gene (Fig. Identification of host factors that support viral replication is … However, TARDBP is a multifunctional protein that can bind to either RNA or DNA and is well known to bind to 3′ UTR regulatory regions or splicing regulatory sites in RNABriefly, we identified TARDBP as a host factor that facilitates HBV gene expression by stimulating transcription from the core promoter, assembly of protein complexes implicated in transcriptional and post-transcriptional stages of the virus life cycle, and suppressing pgRNA splicing during nuclear export. Regulation of the Hepatitis B virus replication and gene expression by the multi-functional protein TARDBP This infographic about hepatitis B virus explores its replication cycle, natural history of infection and pathogenesis, and how this can be controlled and treated. Wollerton, M. C., Gooding, C., Wagner, E. J., Garcia-Blanco, M. A. 2020 Jul;42(7):805-815. doi: 10.1007/s13258-020-00932-w. Epub 2020 May 27.Liou AT, Liao CC, Chou SF, Chang YS, Chang CS, Shih C.J Biomed Sci. The lysates were transferred to a micro-centrifuge tube and centrifuged at 13k × g for 10 minutes to pellet the cell debris at 4 °C. Values of P < 0.05 were considered to be statistically significant.An amendment to this paper has been published and can be accessed via a link at the top of the paper.Schweitzer, A., Horn, J., Mikolajczyk, R. T., Krause, G. & Ott, J. J. Estimations of worldwide prevalence of chronic hepatitis B virus infection: A systematic review of data published between 1965 and 2013. If you've been infected with hepatitis B, take steps to protect others from the virus. 2018 Oct;158:34-44. doi: 10.1016/j.antiviral.2018.07.019. In brief, a fragment containing human TARDBP CDS was amplified from the pcDNA3.1/FLAG-TARDBP plasmid by PCR using the primers, 5′-TGGTTCCGCGTGGATCCATGTCTGAATATATTCGGGTAACC-3′ and 5′-AGTCGACCCGGGAATTCTACATTCCCCAGCCAGAAGACTT-3′ and ligated into the BamHI-EcoRI site of pGEX-4T-1 vector. Virus Resistance to Nucleos(t)ide Analogues. Copyright © 2018 Elsevier Ltd. All rights reserved. Taken together, our results demonstrate that TARDBP is involved in multiple steps of HBV replication via binding to both HBV DNA and RNA. You can also search for this author in As noted earlier, TARDBP has two RNA Recognition Motifs (RRM1 and RRM2) through which it is able to bind to DNA and RNA targets. This site needs JavaScript to work properly. To obtain Epub 2015 Jul 22.J Virol. Following infection, the virus gains entry into hepatocytes via its receptor, the human sodium taurocholate cotransporting polypeptide (NTCP)To further understand the molecular mechanisms behind the control of HBV replication and pathogenesis, we identified novel host factors that could play a role in the viral lifecycle using primary human hepatocytes derived from human hepatocyte transplanted chimeric mice, an infection system that we recently establishedIn this study, we demonstrate that TARDBP is a novel host factor that can enhance HBV gene expression via both transcriptional and post-transcriptional mechanisms. The DNA was purified by the MinElute Reaction Cleanup Kit (QIAGEN: 28204) followed by qPCR analysis (BIO-RAD CFX 96 Real Time System). Zang, W. Q., Li, B., Huang, P. Y., Lai, M. M. & Yen, T. S. Role of polypyrimidine tract binding protein in the function of the hepatitis B virus posttranscriptional regulatory element. Mechanistically, we found that the protein binds to the HBV core promoter, as shown by chromatin precipitation as well as mutagenesis and protein-DNA interaction assays. Persistent HBV infection is caused mainly by ccc DNA and immune tolerance to HBV antigens in the liver. and Y.I. Moreover, we report that the protein has an inhibitory effect on splicing of pregenomic (pg) HBV RNA, which may help the virus export noncanonical unspliced RNAs from the nucleus despite the normally close association between splicing and nuclear export.To examine whether TARDBP plays a role in HBV gene expression, we performed gene silencing assays using the human hepatocyte cell line HepG2 with stably expressed NTCP (HepG2-hNTCP) as the HBV infection modelEndogenous TARDBP regulates HBV gene expression in a HBV infection model.